Polymorphic microsatellite loci in the endangered butterfly Lycaena helle (Lepidoptera: Lycaenidae)

Six polymorphic microsatellite loci were isolated in the endangered butterfly Lycaena helle. Five of them provided interpretable results. We detected four to 34 alleles per locus in a total of 235 samples (males and females) collected from meadows in the Ardennes-Eifel (Germany, Luxemburg and Belgium) and the Westerwald (Germany). We collected one leg for DNA-extraction as a non-lethal method. The expected heterozygosities ranged from 48.6% to 83.1%, depending on the locus analysed. These markers are currently being used in our studies of the species ́ phylogeography over its western Palearctic distribution area and for the analysis of the conservation status of the fragmented populations in Central Europe. 361 72.1 68.5 34 54 401 (GT)24 F: AGTAGCCATTTTACCGTCAG R: CTACGCAACGGATTTTGATG EU117180 LheF12 73.8 78.8 13 53 448 (TG)26 F: AAATCAAGTCACGCATAC R: CCTTAATCGATGGCAATTTC EU117179 LheE12 78.0 52.5 28 54 486 (TA)8 F: CCTTTCCACATATAGTTGGC R: CATCGTCAGGTCACTTCATC EU117178 LheB06 83.1 55.3 26 56 281 (AT)18 F: GTTGTTTTCGAGCCAAGGAG R: AGTGACGATTCCGATGACTC EU117183 Lhe14 – – – 55 299 (CA)15 F: ACTTTTGGTGATCTCTTAAG R: AACATAATGGTTTGCCGCTG EU117182 Lhe13 48.6 54.2 4 53 271 (GACA)5 F: GCGCAAACTATTCAGTTTAC R: ACTTAAATGTTTCTCGGCTC EU117181 Lhe03 He Ho A Ta (°C) Size of sequenced allele (bp) Repeat motif Primer sequence (5 ́–3 ́) GenBank Accession no. Locus TABLE 1. Characteristics of six polymorphic microsatellite loci in Lycaena helle. Abbreviations: F – forward primer; R – reverse primer; Ta – annealing temperature; A – mean number of alleles; Ho – observed heterozygosity; He – expected heterozygosity; 235 individuals were analysed for each locus. Microsatellite loci were amplified in a reaction mixture of Thermozym Mastermix (Molzym, Bremen, Germany) and about 20–100 ng diluted DNA, depending on the locus analysed. To reduce costs and laboratory work, two microsatellite markers were multiplexed. The multiplex contained two pairs of primers, Lhe03 and LheE12 loci were amplified. The loci LheF12, LheB06, and LheE14 were amplified separately. The PCR amplifications were performed in a total of 27.6 μl for the multiplex which contained 25 μl Thermozym Mastermix, 3 pmol for each primer of the Lhe03 locus and 10 pmol for each primer of the LheE12 locus. For LheF12, LheB06, and LheE14 a total of 16 μl contained 10 μl Mastermix and 5 pmol for each primer. Amplification was initiated with 1 min of denaturation at 94°C followed by 45 cycles involving 30 s of denaturation at 94°C, 30 s of primer annealing at a temperature ranging from 53 to 56°C (Ta°C) and 1 min of extension at 72°C, and a final extension step at 72°C for 2 min following a cool down to room temperature (see Table 1). 10 μl of the PCR products were loaded and PCR fragments resolved by electrophoresis on 2.4% agarose gels stained with ethidium bromide as a control before scoring the microsatellites using an automated sequencer running Megabace software (GE Healthcare, USA). Significant deviations from Hardy-Weinberg equilibrium (p < 0.05) were detected for two of these loci. With the program Micro-checker (van Oosterhout et al., 2004) we found strong evidence for null alleles for the loci Lhe B06 and Lhe E14. No significant linkage disequilibrium was detected among any two loci (p > 0.05). The total number of alleles ranged from four to 34 per locus with a total value of 105 alleles detected over all populations. The expected heterozygosity averages over all populations analysed for the five loci ranged from 48.6% to 83.1% (Table 1). The expected and observed heterozygosity for these loci was calculated using GenAlEX (Peakall & Smouse, 2006). ACKNOWLEDGEMENTS. We acknowledge a grant from the Ministère de la Culture, de l’Enseignement Supérieur et de la Recherche, Luxembourg (grant number BFR05/118) and the Musée National d’Histoire Naturelle Luxembourg which funded this study. We thank F. Zachos for useful comments and D. Kime (La Chapelle-Montmoreau, France) for the English correction.